CLADISTICS AND GENETICS | A CLADISTICS EXERCISE | PART 2

CLADISTICS AND GENETICS

Scene from movie Jurassic Park (1993) showing a raptor under a grid, the light that passes through it rather than random shadows, are actually DNA sequences

The movie Jurassic Park, mainly the first one that came in 1993, really got the public's minds wrapped around the idea of dinosaurs and how genetics are an amazing technology.

There is this thing about Jurassic Park we don't see much in movies, rather than non-sense sciencey terms, like in the Resident Evil live-action movie series, a really good example of that spins around the core plot element of the series, the T-virus which is turning people into zombies, however, in Resident Evil 4: Afterlife (2010), at 16:00 through 16:10, Wesker starts telling Alice what the serum he injected in her does:

"...The serum I've injected you with is neutralizing the T-cells in your body [...]" - A. Wesker, RES4 (2010)

However, viruses don't have cells, in fact, one of the defining traits of a virus is that they don't build cells, they build envelopes of simple proteins, and a capsid shell. Anyone who tries to argue saying that he refers to cell as the carrier of the virulent DNA or RNA, is then talking about a plasmid delivered by an active or dormant bacterial agent, not exactly what defines a virus in itself.

An influenza-like virus particle structure

Now, other than nitpicking old movies, let's sink right into science, right?

VSauce 2

TREY the Explainer makes a really good job talking about cladistics in the movie Avatar (2009), and I really recommend you to go watch his material now, before following this up.

Cladogram of Pandoran life shown in the video

The reasoning shown is an introduction to Cladistics (greek, κλάδος = branch) also known as Phylogenetic Systematics, it is a scale of Biological Systematics based on the phylogenetic principle and that groups species or taxa into natural groups (generating hierarchical classifications or not) according, solely, to hypotheses of evolutionary relationships.

It must be understood that life doesn't walk towards a perfect body-plan or goal, it radiates to fill in available ecological niches at a certain window of time, and with the available "tools" at it's disposal.

In times of stable conditions, evolution or evolutionary radiation may not occur as fast as it sometimes appears to be, because that kind of animal has found it's niche, and thus it's been following a certain set of characteristics to live in this niche ever since - even when within it's DNA it have been suffering mutations for natural reasons (cosmic rays, sexual selection, natural selection).

In times post-extinction for example, these mutations have more potential to show up, as the lack of competition for a certain niche, implies that even the genes, before seem as bad for reducing the organism's chance of survival, let's say vibrant colors, now have a neutral effect on the organism, because now it has no predators to spot them for it's color. If this trait of having vibrant colors helps the organism to scare the competition off, then this now turned up to a helpful trait, and now we have an evolutionary radiation full of colored animals.
That of course, is an oversimplification but when the right traits and inter-niche relationships are met, we can get similar events to those described.

The lines in a cladogram relate certain groups of animals, or species if you are working with - with one another, the branches of the resulting tree are called Phylum.
The Phyla are then classified in Mono- (from a single branch), Para- (from parallel branches), and Polyphyly (from multiple branchings), or -phyletic groups.

A more general way to see cladistics, is the grouping of animals by shared characteristics, for a long time - until the arise of genetic studies - the only way we could organize animals, for that we will have to first agree that the earliest organism that have existed was very simple, sharing only the core elements of every other animal today, and that as the time passed, the level of complexity have been increasing over time. That view of evolution may be as well, why we as one of the recent species of this world, tend to think we are the pinnacle of evolution, and tend to be rather amazed to see birds and octopuses doing stuff we didn't really expected them to be able to do, lacking many characteristics we humans have.

 A simple cladogram relating groups of animals by shared characteristics

The more closer in a branch or system of branchings two organisms are, the more they are related, in the image shown above, reptiles and fish are related because they have a backbone, however, mammals are more closely related to reptiles than fish because they have watertight eggs, four limbs and a backbone.

Those core characteristics are easily groupable on a macro scale, however, when it comes to speciation, when those key characteristics are just subtle differences in skull or pelvis shape, like the on the classification of hominids, the work must be done with dozens, if no hundreds of small differences in order to properly relate them, in which case, they require for a large sample (to account for individual differences) or a well preserved few samples - things that are quite rare for most of the fossil record.

That's when Genetics come to be handy, genetics can help us understand beyond the subtle differences in skeletal morphology, and into the deep history of a group of animals - the downside of it, is that you need DNA, and because of that, you need live specimens, or at least, it's fluids - so it's impossible to use DNA analysis to relate two dinosaurs, except, you kinda can, if there are living relatives of those dinosaurs for example, but as for most of them are extinct, anatomical differences and paleogeography are among our best tools.

Before we get ahead of ourselves, and enter the realm of phylogenetics, let's take a look at the types of Character States.

CHARACTER STATES

Describe the particular characteristics among groups of organisms, or Character States.

Which character states can you identify in this cladogram?

Plesiomorphy

Ancestral traits that are retained by two or more taxa during evolution.

Ex; The forward facing eyes of primates, the four limbs in all tetrapods, the six limbs in Pandoran hexapods, the fused digits in bird wings.

Apomorphy

Derived traits from existing Plesiomorphisms, characteristic to a group.
Ex; Nails in primates instead of claws from other mammals, the number of digits in reptiles and amphibians, the capacity of speech from humans, or to sing from songbirds.

Autapomorphy

Traits present in only one particular species, or group.

Ex; Again the human capacity of speech, the similarities between Great Apes hands, the long neck of Sauropods.

Synamorphy

Trait defines an entire group of clades.

Ex; All tetrapods have digits regardless of their number.

Homoplasy 

Trait exists in two clades, or groups, or species, but not in their common ancestor, likely as result of convergent evolution, or reversal evolution (recovery of lost traits, like colors cited earlier).

Ex; Endothermy blood in both mammals and birds even though when the lineages of mammals and birds split there was no such thing. The relationship between dolphin and shark body-plans.

When we are presented with a group of animals, and our task is to relate them, we can gather a number of traits they have and use that to group them.

Let's suppose we have 6 animals that we want to group, A through F, and we have traits 1-10 we are looking for, 1 marks a YES, and 0 marks a NO for having the trait.

Trait 1 is exclusive to clade CD, 2 is also exclusive to clade AB, 3 is a defining trait of group B, 4 is defining trait of the clade A-D, 5 is as well for clade EF, 6 and 7 are a defining trait of group A, while 8 is defining to group D only, as well is 9 for group F, trait 10 however appears in both E and C that are completely unrelated if not by the common ancestor of them all.

Be these traits from live or fossil, we can always use that to organize animals and plants too, starting from the most basal traits, like 4 and 5 in the example, going up to the more subtle ones like 7, 3, or 8.

However, doing that without the aid of the fossil record in telling at what time such a trait became a thing is a little hard the say the least - without the help of phylogenetics.

Traits are defined by genes, and the further two organisms are from each other in the tree of life, as well the differences in their traits - it is expected to see something similar in their genome - as the further away the organisms are, the further they have in common, and then their similarities wander more and more in the realm of basal traits than in specialized functions.

Consider the following DNA sequence in a group of hypothetical animals:

1: TAAGGTAGCTACCAATATTGAGTTTTTTACCCTAGCGACACACCTCCGACC

2: TAAGATAGCTACCAATATTTAGTTCTTTAGCCTTCCGACATACCTCCTACT

3: TAAGATAGCTACCAATATTTAGTTCTTTAGCCTTGAGACAGACCTCCTACA

4: TAAGATAGCTACCAATATTGAGTTTCTTAGCCTTGCAACAGAGCTCCTACG

Animals 1 and 4 only share one gene TGA, and thus should be distantly related.

Animals 3-4 have the GAT gene, 2 and 3 are somewhat related to 4 but not to 1.

2 and 3 differ for 3 genes after CTT.

4 and 1 also have way more genes that do not appear in the other animals other than themselves.

(All animals have different ends for this DNA sequence)

As the defects and changes in DNA stack over time, the one species or group with most genetic diversity is the older one.

4 and 1 come from a common ancestor and diverged long ago.

The split between 4 and 1 also happened before the GAT gene appeared in the group 4.

2 and 3 split recently from a common ancestor that had the genes GAT and CTT in this particular sequence, and 2 is the one that mostly resembles it.

Now, we have to find out when did those splits occur, because, by any scale, 1 and 4 could be humans and jellyfish, or crocs and birds.
If we know how often do these animals reproduce and how much they live, we can figure out the approximate rate of mutation in this clade's DNA, of course, this does not account for evolutionary irradiations, when the gene pool have not really big restrictions from environmental pressure, and then the rate of mutation can increase in events like post-extinction or access to new resources, like KT extinction or the Cambrian Explosion.

And here comes the Molecular Clock analysis - and actually, there is a lot of complicated maths behind it - I found a simplified explanation about it.

Let's follow a 2% rule for this case, which means, evolution drives these taxons DNA 1% away from each other for each million years they're apart.

There is 17 codons in each DNA we are analyzing, most of the highlighted codons differ in just 1 letter, except 1's AGC and 2's TCC which differ in 2 letters.

1 and 4 differ from 5 of 10 codons after TGA and 1 codon before, or 6/17, about 35,29%, so they have split about ~35,3 million years ago.

2 and 3 differ only by about 3 codons, having split about ~17,6 Mya.

As 2 is the older from the clade 2-3, the comparison between 2 and 4 renders 5 codons of difference, so the common ancestor of 2 and 3 had split from 4 about ~29,4 Mya.

So here is a more precise cladogram of these animals.

However, when that rule isn't possible to follow, you can use the aid of the fossil record, if the lineages 2 and 3 had split about 5 million years ago according to the fossil record, then, 17,64 / 5, the given rate is ~3,52% per million years. And so the common ancestor of 2 and 3 had split from 4 about 8,3Mya, and subsequently, 1 and 4 split about  10 million years ago.

And for our luck in this thought experiment, we have DNA from living relatives of all those.

I hope to have helped you to get a further look into the mechanisms behind evolution and how organisms are related to each other.That's a good way to deal with things inside a Problematica clade, a place reserved for creatures whose fossil record is insufficient to pinpoint them in a particular branch inside the Tree of Life, and / or are just waiting further study to be later classified into some existing or new branch.

- M.O. Valent, 10/05/2020